ID: 1180898066_1180898076

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1180898066 1180898076
Species Human (GRCh38) Human (GRCh38)
Location 22:19351848-19351870 22:19351887-19351909
Sequence CCAGCCCGCAGGAGGTAAGAGAT AAGAGGGGCAACTGAGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 82} {0: 1, 1: 0, 2: 2, 3: 34, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!