ID: 1180910452_1180910461

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1180910452 1180910461
Species Human (GRCh38) Human (GRCh38)
Location 22:19446715-19446737 22:19446740-19446762
Sequence CCCCCCTGAGACAGGTCTCCCTC TTATCCAGGCTGGTGTGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 256} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!