ID: 1180945258_1180945272

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1180945258 1180945272
Species Human (GRCh38) Human (GRCh38)
Location 22:19689024-19689046 22:19689065-19689087
Sequence CCTGCCACCCTCTGCTCACAGGC AGGAGCTGGCCGGTGGAAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 19, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!