ID: 1180952428_1180952438

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1180952428 1180952438
Species Human (GRCh38) Human (GRCh38)
Location 22:19726636-19726658 22:19726672-19726694
Sequence CCGTGAGGACGCTGTGGGGGCGG GGGGCGGTGAGGACGCTGTGGGG
Strand - +
Off-target summary {0: 2, 1: 5, 2: 8, 3: 12, 4: 169} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!