ID: 1180962749_1180962759

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1180962749 1180962759
Species Human (GRCh38) Human (GRCh38)
Location 22:19769622-19769644 22:19769658-19769680
Sequence CCAGCCACTACCGTTCCTGTGGA TGGGCAGCTGCCCTAAGGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 68, 4: 1408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!