ID: 1181005608_1181005622

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1181005608 1181005622
Species Human (GRCh38) Human (GRCh38)
Location 22:20012087-20012109 22:20012135-20012157
Sequence CCCCACCCAGTTGGGGAAGTGTG TCATGGGCCTCCTACCTCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!