ID: 1181010127_1181010135

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1181010127 1181010135
Species Human (GRCh38) Human (GRCh38)
Location 22:20035392-20035414 22:20035444-20035466
Sequence CCATGTCCCAGCTGTGAGCACTG ATTGCACATGTGCACATTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 344} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!