ID: 1181022806_1181022820

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1181022806 1181022820
Species Human (GRCh38) Human (GRCh38)
Location 22:20112519-20112541 22:20112552-20112574
Sequence CCCTGGGAGCCCTTCAGCTCCTG GGGTCCTGGGCCTAGGATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 284} {0: 1, 1: 0, 2: 0, 3: 26, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!