ID: 1181022806_1181022823

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1181022806 1181022823
Species Human (GRCh38) Human (GRCh38)
Location 22:20112519-20112541 22:20112557-20112579
Sequence CCCTGGGAGCCCTTCAGCTCCTG CTGGGCCTAGGATGAGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 284} {0: 1, 1: 0, 2: 3, 3: 47, 4: 450}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!