ID: 1181024261_1181024264

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1181024261 1181024264
Species Human (GRCh38) Human (GRCh38)
Location 22:20118791-20118813 22:20118809-20118831
Sequence CCAAGTTCTGGTGTCTCACTCTG CTCTGTGCTCACATGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 257} {0: 1, 1: 0, 2: 4, 3: 35, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!