ID: 1181026792_1181026802

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1181026792 1181026802
Species Human (GRCh38) Human (GRCh38)
Location 22:20131642-20131664 22:20131667-20131689
Sequence CCGAGGCCGCGGGGTCCTGCCCC CCGAAGGTCCCGCGAACCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 288} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!