ID: 1181047789_1181047803

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1181047789 1181047803
Species Human (GRCh38) Human (GRCh38)
Location 22:20223810-20223832 22:20223848-20223870
Sequence CCCTGCTGCCCATGTGTGAGGAC TCCAGCTGGGCCCCAGGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!