ID: 1181069257_1181069258

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1181069257 1181069258
Species Human (GRCh38) Human (GRCh38)
Location 22:20322341-20322363 22:20322386-20322408
Sequence CCATTGTGCGCGCGCGCACACAC AAAGTTCCTTTTCTTTTTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 12, 3: 89, 4: 885}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!