ID: 1181085158_1181085170

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1181085158 1181085170
Species Human (GRCh38) Human (GRCh38)
Location 22:20436480-20436502 22:20436494-20436516
Sequence CCCCCGCCCCGGAGGCGGGGCTC GCGGGGCTCGCAGCGGGGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 29, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!