ID: 1181124519_1181124535

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1181124519 1181124535
Species Human (GRCh38) Human (GRCh38)
Location 22:20694407-20694429 22:20694458-20694480
Sequence CCTGCTGCTGCCACGGGCCCTGT CTGTGTCAGGGAAATGATCATGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 2, 3: 20, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!