ID: 1181127277_1181127288

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1181127277 1181127288
Species Human (GRCh38) Human (GRCh38)
Location 22:20709573-20709595 22:20709599-20709621
Sequence CCCAGCATCACCTGAGTGGCCCC GCATTAGGGGACTAAGCATTGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 11, 4: 159} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!