ID: 1181131173_1181131187

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1181131173 1181131187
Species Human (GRCh38) Human (GRCh38)
Location 22:20733289-20733311 22:20733341-20733363
Sequence CCCTCCTCCCTCACTGCCCACAG ACTTGTGGCAGATCAGGGCAAGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 11, 3: 119, 4: 1038} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!