ID: 1181135610_1181135615

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1181135610 1181135615
Species Human (GRCh38) Human (GRCh38)
Location 22:20763922-20763944 22:20763952-20763974
Sequence CCTTTCTTTTATGTATTGAGCTT CTATTTTACTAGAGGGTTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!