ID: 1181165850_1181165867

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1181165850 1181165867
Species Human (GRCh38) Human (GRCh38)
Location 22:20982568-20982590 22:20982620-20982642
Sequence CCCGGTACGGTGGGCTTCATGGG GGGTCCCAGGGCGGGTCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 61} {0: 1, 1: 0, 2: 4, 3: 38, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!