ID: 1181167955_1181167963

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1181167955 1181167963
Species Human (GRCh38) Human (GRCh38)
Location 22:20993341-20993363 22:20993379-20993401
Sequence CCAGTGTGAGGACGCAGGTCCAG CAGAGCTCTGCTGAGGCCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 52, 4: 482}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!