ID: 1181170818_1181170822

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1181170818 1181170822
Species Human (GRCh38) Human (GRCh38)
Location 22:21008873-21008895 22:21008895-21008917
Sequence CCTCTGTACAACATGCAGCAGGC CCATGTACTTGCCATGGTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 4, 3: 12, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!