ID: 1181174985_1181174997

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1181174985 1181174997
Species Human (GRCh38) Human (GRCh38)
Location 22:21030217-21030239 22:21030250-21030272
Sequence CCAGGGTGCCCGCCACAGGCACC GGTGCACATGGGCAAACACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 255} {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!