ID: 1181176092_1181176098

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1181176092 1181176098
Species Human (GRCh38) Human (GRCh38)
Location 22:21036972-21036994 22:21037000-21037022
Sequence CCCTACAGTTTCTGGTGACAAGG ATCCTCTCAAGCCTAAAGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!