ID: 1181181787_1181181793

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1181181787 1181181793
Species Human (GRCh38) Human (GRCh38)
Location 22:21073647-21073669 22:21073689-21073711
Sequence CCGTTTCACCATTTGTCATCTTG GTCTGAGACGCCATGGATCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!