ID: 1181213163_1181213171

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1181213163 1181213171
Species Human (GRCh38) Human (GRCh38)
Location 22:21303699-21303721 22:21303739-21303761
Sequence CCTTCTCCAGGGAGCCACGGGGC CTCTGCAAGCAGCTGGATGAAGG
Strand - +
Off-target summary {0: 3, 1: 8, 2: 2, 3: 24, 4: 260} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!