ID: 1181221600_1181221617

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1181221600 1181221617
Species Human (GRCh38) Human (GRCh38)
Location 22:21367529-21367551 22:21367573-21367595
Sequence CCTGTAGCACTGCAAACACAGGC GAGGGTGTGCACAAGGGGCAGGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 6, 3: 29, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!