ID: 1181221691_1181221703

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1181221691 1181221703
Species Human (GRCh38) Human (GRCh38)
Location 22:21367911-21367933 22:21367939-21367961
Sequence CCCACCCTTCACAACTCTCTTCC CAGCACCACAGGGGCCCTCCTGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 0, 3: 38, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!