ID: 1181225464_1181225472

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1181225464 1181225472
Species Human (GRCh38) Human (GRCh38)
Location 22:21388070-21388092 22:21388112-21388134
Sequence CCACAGCAGGCAAGGACAAGCTC CCAGCTCCATGAGCCCAGCTCGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 11, 4: 163} {0: 3, 1: 0, 2: 1, 3: 36, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!