ID: 1181226535_1181226546

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1181226535 1181226546
Species Human (GRCh38) Human (GRCh38)
Location 22:21394940-21394962 22:21394990-21395012
Sequence CCTGTAGTTCCAGCACTTTGGAA AAGGAGTTGGAGACCAGCATGGG
Strand - +
Off-target summary No data {0: 3, 1: 82, 2: 3041, 3: 38656, 4: 68685}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!