ID: 1181230229_1181230235

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1181230229 1181230235
Species Human (GRCh38) Human (GRCh38)
Location 22:21417547-21417569 22:21417563-21417585
Sequence CCGACGCACACGAGGTGAGGGGC GAGGGGCGGCCTTGTGGGGCGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 5, 4: 60} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!