ID: 1181230229_1181230251 |
View in Genome Browser |
Spacer: 21 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1181230229 | 1181230251 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 22:21417547-21417569 | 22:21417591-21417613 |
Sequence | CCGACGCACACGAGGTGAGGGGC | CGGGGAGCGGGCGGGGGCCGGGG |
Strand | - | + |
Off-target summary | No data | {0: 3, 1: 1, 2: 37, 3: 263, 4: 2089} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |