ID: 1181239545_1181239556

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1181239545 1181239556
Species Human (GRCh38) Human (GRCh38)
Location 22:21468934-21468956 22:21468982-21469004
Sequence CCACACCCAGGACGCGCTGCAGA GGAGCAGACCGTAGTCCTGCAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 6, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!