ID: 1181243917_1181243928

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1181243917 1181243928
Species Human (GRCh38) Human (GRCh38)
Location 22:21492583-21492605 22:21492620-21492642
Sequence CCCTAGCCCGCTTGGCCTGACCA TCCAGAGGTTTCACTGCCTAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 5, 4: 79} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!