ID: 1181250338_1181250344

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1181250338 1181250344
Species Human (GRCh38) Human (GRCh38)
Location 22:21529484-21529506 22:21529537-21529559
Sequence CCTGGGTCTCCTGCTCCTGATCA GTCTCCACCATTAGACTGGCAGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 0, 3: 36, 4: 280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!