ID: 1181252106_1181252114

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1181252106 1181252114
Species Human (GRCh38) Human (GRCh38)
Location 22:21539861-21539883 22:21539898-21539920
Sequence CCAACTCCTTGGCTCAAGCGATC TTCCAAAGTGCTGGAACTACAGG
Strand - +
Off-target summary {0: 6, 1: 365, 2: 3106, 3: 9897, 4: 37717} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!