ID: 1181253781_1181253783

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1181253781 1181253783
Species Human (GRCh38) Human (GRCh38)
Location 22:21549763-21549785 22:21549776-21549798
Sequence CCTGCACGCCGCAGCTGCTTGTT GCTGCTTGTTCTCCTCTTGCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 10, 4: 105} {0: 2, 1: 1, 2: 1, 3: 16, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!