ID: 1181256849_1181256864

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1181256849 1181256864
Species Human (GRCh38) Human (GRCh38)
Location 22:21568159-21568181 22:21568203-21568225
Sequence CCGGAGCCCGCGCCGCGGAACCG GCCGGGCTTGCAGCTCCGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 108} {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!