ID: 1181267769_1181267775

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1181267769 1181267775
Species Human (GRCh38) Human (GRCh38)
Location 22:21641060-21641082 22:21641091-21641113
Sequence CCCTCAAGTGCAGGGACTACCAA CAGACTGACTTTTAACCGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 258, 4: 447} {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!