ID: 1181295496_1181295504

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1181295496 1181295504
Species Human (GRCh38) Human (GRCh38)
Location 22:21835176-21835198 22:21835201-21835223
Sequence CCTGCCTGTAGTCCCAGCTACTC GAGGCTGAACTGAGGGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 7, 3: 119, 4: 1112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!