ID: 1181313973_1181313982

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1181313973 1181313982
Species Human (GRCh38) Human (GRCh38)
Location 22:21960258-21960280 22:21960278-21960300
Sequence CCAACATCCAGGGAGAAGCCAGG AGGGAGCCTCGGTGGGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 53, 4: 352} {0: 1, 1: 0, 2: 5, 3: 34, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!