ID: 1181314960_1181314974

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1181314960 1181314974
Species Human (GRCh38) Human (GRCh38)
Location 22:21964938-21964960 22:21964990-21965012
Sequence CCAGAGACCACCAGCTTTCCAGC AGACTGAGGAGATGAGGCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 78, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!