ID: 1181471072_1181471080

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1181471072 1181471080
Species Human (GRCh38) Human (GRCh38)
Location 22:23140276-23140298 22:23140319-23140341
Sequence CCATGAGGGCTTTCTGCCTCGTC CTCCTCCTTCAGCTTGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130} {0: 1, 1: 1, 2: 2, 3: 55, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!