ID: 1181478233_1181478243

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1181478233 1181478243
Species Human (GRCh38) Human (GRCh38)
Location 22:23181349-23181371 22:23181365-23181387
Sequence CCGCCCGCAGGCCCGGGGCAGCC GGCAGCCGCGTCGGGGGAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 469} {0: 1, 1: 0, 2: 0, 3: 6, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!