ID: 1181490659_1181490667

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1181490659 1181490667
Species Human (GRCh38) Human (GRCh38)
Location 22:23258964-23258986 22:23258993-23259015
Sequence CCTCTGACTGCAGGCAGGGCCAT CAGGCGGAACAAAGGGAGCACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 23, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!