ID: 1181507849_1181507857

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1181507849 1181507857
Species Human (GRCh38) Human (GRCh38)
Location 22:23373702-23373724 22:23373732-23373754
Sequence CCTGGTCCTTGAAGGCCCAGTTC CGTGCTGATCCCATGTGCTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!