ID: 1181507854_1181507857

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1181507854 1181507857
Species Human (GRCh38) Human (GRCh38)
Location 22:23373718-23373740 22:23373732-23373754
Sequence CCAGTTCCCGGGAGCGTGCTGAT CGTGCTGATCCCATGTGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 43} {0: 1, 1: 1, 2: 0, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!