ID: 1181512345_1181512361

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1181512345 1181512361
Species Human (GRCh38) Human (GRCh38)
Location 22:23394577-23394599 22:23394630-23394652
Sequence CCCTGCGTGCCCCTGGCCCTGAC GCTGCTGCTGGGCACCCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 356} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!