ID: 1181523040_1181523059

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1181523040 1181523059
Species Human (GRCh38) Human (GRCh38)
Location 22:23460232-23460254 22:23460275-23460297
Sequence CCCCTGTCCAGGTCCTCAGACTG AGGAGCTGTGTAGGGAGGGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 27, 4: 263} {0: 1, 1: 2, 2: 28, 3: 200, 4: 839}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!