ID: 1181541432_1181541442

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1181541432 1181541442
Species Human (GRCh38) Human (GRCh38)
Location 22:23575058-23575080 22:23575098-23575120
Sequence CCAGGAGCCGCGCTGGAGCAGGA GGCACAGGGCTGCAGTGTGTAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 12, 4: 175} {0: 3, 1: 0, 2: 1, 3: 32, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!