ID: 1181543604_1181543606

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1181543604 1181543606
Species Human (GRCh38) Human (GRCh38)
Location 22:23587848-23587870 22:23587878-23587900
Sequence CCACCTTAATTGCGTCTGCACTG TTAGCAAGATTCCTGCTAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!